Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E538262

Search information 
Request: 538262Match: SGN-E538262
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189261Clone name: TUS-57-F11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C61958 [cLEM-1-A12] Trace: SGN-T83802 EST: SGN-E270429 Direction: 5' Facility: TIGR
Clone: SGN-C189261 [TUS-57-F11] Trace: SGN-T339140 EST: SGN-E538265 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538262Length: 496 bp (851 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538262 [] (trimmed) AGACAAACTAAACAGAGTTTATTAGACATAACAAAGTAGTTGCAAAGTACAAATCTGAAAGACAAGGAACCTGTACAATCAAAGGACTTTTGACA
ATCCTATCAAAAACTAGAACTTGAACACTAGAAAAACAATCTAGATGGACTAGTTGCCATGATCAAGCTCCAGGTTAACAGATACCATGCTACAG
AAATCGTTCGATTCAACTACAGACTAAAACGGGAAGTAAAACACTTTATAACAACGAGGACGACTTCTTAATACGAAAACTAACATACTAGAACT
ATGAAAGACTGTCTGATTCTGCAGTGGAGTACTAATACCCAAGGGGAATGCATGATATCCATGTAAATTTTAGAGAAGCATAATTAGTTCATCCA
CGAAAGACGGGAGAAGGAGCCACACTAGTGAAAACTTTAGCACCAGGACTTAGGTAACTGTAATCTCCGGATACCGTGGTTGGGGAAAGAGGCAC
CCTCCGTGTGAAACCGGAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538262] SGN-U578110 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339137 [Download][View] Facility Assigned ID: TUS57F11_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0063 Quality Trim Threshold: 20.5