EST details — SGN-E538910

Search information 
Request: 538910Match: SGN-E538910
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189668Clone name: TUS-58-G10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73138 [cLER-3-G7] Trace: SGN-T92230 EST: SGN-E277342 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538910Length: 132 bp (847 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E538910 [] (trimmed) GTAGTATCATCGAAATTTCCTTCCTTCGCAACCAAATTTATGAAAAACAAGTGTACTTAGCACTATGAATAATTCACAAAAGATGATTTGTTTTT
CTTATTTACATAAGGAGTAATACAAATTTTACAGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538910] SGN-U575975 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339785 [Download][View] Facility Assigned ID: TUS58G10_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0475 Quality Trim Threshold: 12.5