EST details — SGN-E539058

Search information 
Request: 539058Match: SGN-E539058
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189754Clone name: TUS-58-J24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73815 [cLER-6-E2] Trace: SGN-T93295 EST: SGN-E277565 Direction: 5' Facility: TIGR
Clone: SGN-C189754 [TUS-58-J24] Trace: SGN-T339935 EST: SGN-E539060 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539058Length: 429 bp (829 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539058 [] (trimmed) GATGTAAAACCAATATATGTATTCAACTTACATATAAATCATCTCATTGATAAATGTTATTTTTTAAAAATTAAAATATGATTTGTTTTATAACA
TACTAAAGTATGGAGAAAAAAAAAGGGAGGAGAATATTGGAACAAATCATCTCTAAACTAATAAAATCAAATAGAAACAAATACAGGTTAAATAA
AATAAATACATATGATTCATGCAACTGATAACAAATAACTTGTTCAAAATAGAAAATTCTCCATAACTAGTCCGTACAATACTACTTGGCCGCCG
GTAGCCTTCAGTATTTACAAATACACTCCAAACAAAAAGACAAGTACAATAATAGATCTAGCAAAATTTCAGTCGCCGGAATCATCATCGCCACC
GAAGATTGAAAAGCGGTTATAAAGAAGGAACAATGTGAGTGCGAGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539058] SGN-U573015 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T339933 [Download][View] Facility Assigned ID: TUS58J24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5