EST details — SGN-E539565

Search information 
Request: 539565Match: SGN-E539565
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190048Clone name: TUS-59-G6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72019 [cLER-19-O2] Trace: SGN-T96433 EST: SGN-E284861 Direction: 5' Facility: TIGR
Clone: SGN-C190048 [TUS-59-G6] Trace: SGN-T349116 EST: SGN-E548241 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539565Length: 312 bp (832 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539565 [] (trimmed) TTTCTTTCAGAACAGAGCAAAAAATTAAGGTTTAAAAAATGAGTGGTTCCTTGAATCCCCGTTACTACCGCACAGCAAAAGTTGAACAAATTGAG
AAAAAAACAGAAAGGCCGATGGAGTATTTCAGCAGAGAGATACAGAGGCCTAATTCTACGAATATGAGGAAGCCGGCGGCAGCGCCAAAGAAGCT
TGAGAGCAAGCCATCGGAAGACATTAATGAAAGCGCAGAGAATTCATAAAGAAGTTTAACAACAGCTGCTTCTTCAGAGGCTTGAGTCCATAGAA
AACTATGAACAAATGCTTAAGAGGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539565] SGN-U566050 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340440 [Download][View] Facility Assigned ID: TUS59G06_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0145 Quality Trim Threshold: 12.5