Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E539693

Search information 
Request: 539693Match: SGN-E539693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190124Clone name: TUS-59-J10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77115 [cLES-1-P16] Trace: SGN-T97363 EST: SGN-E283687 Direction: 5' Facility: TIGR
Clone: SGN-C190124 [TUS-59-J10] Trace: SGN-T340571 EST: SGN-E539696 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539693Length: 392 bp (910 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539693 [] (trimmed) GGGCCCCGCATAACTCAATATGTAAAATTCCTACTTCCCACTTTTATGAGGACAACGTGGTTTCAAAACTCCATTAAGACATTTCTTTGTGAAGA
AAAACCATCTAGCATTGACAACTAAACACGTATCTTCCGCTGCTCATCGGGAATTAAAATTGGACATATCTCTTCCAGCCCTGTTTGGATTCTGA
TAGGAGTTCCCCTCCGATGTATTAGGAGCGTAACCCTGGTTTGGCCCTGGACCTGTTTGGGAAGGCGTGTCTCCCTTGTTCTGTCCCCCCCCCTT
GGATTGGAAATTACCTGCGTTGTTTGGGATTCCCTAATTTTTGGGAGGCACTCCCCCCCAGTTTGGGGGCATATTTGGGTGGTGCATCCCCCCTC
CACGGGGGGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539693] SGN-U589564 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340568 [Download][View] Facility Assigned ID: TUS59J10_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0292 Quality Trim Threshold: 14.5