EST details — SGN-E541799
| Search information |
| Request: 541799 | Match: SGN-E541799 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C191350 | Clone name: TUS-62-M12 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C90152 [cLEW-1-N8] | Trace: SGN-T111991 | EST: SGN-E299761 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E541799 | Length: 147 bp (824 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E541799 [] (trimmed)
GCGGCGTCATTTGAATTTACAAGATTAGATATGATGCAAACCAACGAATGAACACAAAAGAAACAAGAAGATCCCTCTCATTACTTTCATTGCAA
AAAATACGAGATCAGCGATGAGAAAATCTTGTTCCAGTGCTGTATGGCAATA
AAAATACGAGATCAGCGATGAGAAAATCTTGTTCCAGTGCTGTATGGCAATA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E541799] | SGN-U563828 | Tomato 200607 | Build 2 | 9 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T342674 [Download][View] | Facility Assigned ID: TUS62M12_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.892 | Expected Error Rate: 0.0100 | Quality Trim Threshold: 20.5 |
Working
