EST details — SGN-E543520

Search information 
Request: 543520Match: SGN-E543520
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192348Clone name: TUS-65-G2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92194 [cLEX-10-H14] Trace: SGN-T116750 EST: SGN-E304976 Direction: 5' Facility: TIGR
Clone: SGN-C192348 [TUS-65-G2] Trace: SGN-T344394 EST: SGN-E543519 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543520Length: 482 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543520 [] (trimmed) GACAATTTAAAAGATAGATATGACCACCTGAAGTTGGTCGTCCTTCCACAGCCATGGAAAAGGGAGAAAGCTCTACTCCTACACTTTCCGAAGAC
GAAGTCTGGGCCAAACTCATACCGACAGACTCTCGCTATTCAGAAATTGAGTTAAGGTTGAAGGAGACCGTAATATGCAGTGAAGTAAAGCATTC
TTCTTCTGAAAAGCAAGATTGGTGTAAAATAACAAGGAATGTGGATCTAGATTCTGCCATGATGCAAAATAGAAGTTTGAAAGAAATTCTTGTTG
ATGAGACGGTTGTTCAGGAAGAGCATGCTGCTGTAATTAAGTGTGGCAGTGAAATTTCACTAGGTCCCAGTGATGAAGGTTATGTGAAATACCGA
TTCGAAATAATGCCTACTGAGGAATCTCGCAGGTACATACAGATTTATCTCGATGTCGAGTATGCAAAATGCTGTATCTGCTTGAACATCTGGCA
TGATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543520] SGN-U563891 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344395 [Download][View] Facility Assigned ID: TUS65G02_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5