EST details — SGN-E544753

Search information 
Request: 544753Match: SGN-E544753
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193066Clone name: TUS-67-D24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97063 [cLEY-19-I17] Trace: SGN-T120462 EST: SGN-E306615 Direction: 5' Facility: TIGR
Clone: SGN-C193066 [TUS-67-D24] Trace: SGN-T349969 EST: SGN-E549094 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544753Length: 430 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E544753 [] (trimmed) AATATTCAGATCATAATACAACATTTTTATAATTCAGATGTGTATTCAAATTTAAACACCTAAATCTTAATACACATTTAAATTTAGATATAGAA
TGAAAACAAATAAGAGCTAAGATGACAATATTTTTGTCTTTTTGACATGGTAAATTCATTTAAGGAAAACTAAGTTTAGGAGGAAAAAGGAAAGA
AATAATCCCCAGAAAAGAAAATACTAATTTAGGATTAAGAAACTGAATATCTTCCTTTTCTTGAAGGTGTGTACTTAGCTTCTTCTAAGCTGTCA
GGTGAATCTGAGCCACTATTTTCCCCTTGTTTCCTCCTGCCTTTGCTTGACCAAATTTTTGTAAATATCTTCTTTGATGAAAGTATACTTTTCAT
TCTACCATTGGTAGCCTTGTCAACGTGACGTTTGGTATCACCATTTAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544753] SGN-U584084 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345628 [Download][View] Facility Assigned ID: TUS67D24_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5