Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E544796

Search information 
Request: 544796Match: SGN-E544796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193091Clone name: TUS-67-F1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97265 [cLEY-20-I15] Trace: SGN-T120678 EST: SGN-E307868 Direction: 5' Facility: TIGR
Clone: SGN-C193091 [TUS-67-F1] Trace: SGN-T345670 EST: SGN-E544795 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E544796Length: 507 bp (887 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E544796 [] (trimmed) GATTCCTTCTTCAAGTAACCAATTTTTATTTTTATTTTTTTGAAATATTTCATATATTATTATAATGTGTCCAACTATGAATATTTTGGCAACTG
AAAAAATTAAGGAAAATTATGAGGGGAAAAATGAGTGTAGATATCAAAAAGGAGTTAGACATTTATGTGAAAGTGGAATTACTAAAATTCCAAAA
AAAAATATATTTTGCCAATTTCAGATAGGCCTTTAATTGTGAAAAAAGAAGAAAAAATTGAAGAAAATCTCAATTTGCCTATTATTGATTTTGCT
CAATTGCAAGGCCCCAATAGATCTCAAGTTCTCAAATCACTTGCCAAAGCTTGTGAAGAATATGGTTTTTTTCAGTTGGTGAATCATGGTATACA
TAGTGACACAATTCAACACATCATTGAAGTTGGCAAGAAATTCTTTTGACTTCCCTTTGAAAGAAGAGCAAATACATGTCTATTGACATGCAAGC
ACCAGTTAGAGTTGGCACAAGTTACAATCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E544796] SGN-U562670 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T345671 [Download][View] Facility Assigned ID: TUS67F01_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.903 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5