Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E545910

Search information 
Request: 545910Match: SGN-E545910
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193740Clone name: TUS-69-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100884 [cLHT-11-D18] Trace: SGN-T171430 EST: SGN-E359228 Direction: 5' Facility: TIGR
Clone: SGN-C193740 [TUS-69-A2] Trace: SGN-T346786 EST: SGN-E545911 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545910Length: 297 bp (808 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545910 [] (trimmed) AAGGGAAGTGCTTTCTTTAATCAAATTGTATAATCAATTACTAATAAGTACTATATAATAAGACAGTTCACCATCCATCTGGTCACCTACTTATT
ATTCTTTATGCACTTTTTATCATTAAAATAAAAACTATATACCTTGTATACATCGAATATGGGACTATTATTAATGAACACAGTAATAATATAGA
AAATAGACATCCATATGGTAGCCCAAAACTTTGTTCTGGGCTCTTTTGGAAGCCCAGTACTAAGTAGGGCCATTTCAGTGACCCACAATGATTTT
GGGGCTCATTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545910] SGN-U578597 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346785 [Download][View] Facility Assigned ID: TUS69A02_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0099 Quality Trim Threshold: 20.5