EST details — SGN-C5465

Search information 
Request: 5465Match: SGN-C5465
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C5465Clone name: cLEC-32-A1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173774 is on microarray TOM1: SGN-S1-1-5.1.18.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173774 [TUS-17-A4] Trace: SGN-T191663 EST: SGN-E390337 Direction: 3' Facility: INRA
Clone: SGN-C173774 [TUS-17-A4] Trace: SGN-T191664 EST: SGN-E390338 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207552Length: 387 bp (734 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207552 [] (trimmed) CAGACTTTTACTCCAGCGATTGAAGCCATTTAACTGTAATCTACTTTACCATGACCGTCTTAAGATGGATTCTGAGCTAGAGAATCAAATTGGAG
CAAAGTTTGAGGAAGATCTCGATAAGATGCTCTCGAAATGTGACATAGTGGTCATCAATACGCCTCTTACAGAGAAAACAAAGTAAGGTTTCTGT
TTCTGTAATTACCCGTCGTAAACCTATACAATAATATTTATTGACAAAGCTTCTTATATTCAAGTTATTTTAACAATGACTTAATTATGAAATGA
ACTAAGTAAGCTAAAGTGAATATTCATTGAGAATGAAATATGATATTTAGCGAAGGGAAGGAGAATCTTTGGTGTCATCGCAATTTTTTGGTATC
ACTCTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207552] SGN-U579029 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29765 [Download][View] Facility Assigned ID: TCAEU01THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0169 Quality Trim Threshold: 14.5