EST details — SGN-E546666

Search information 
Request: 546666Match: SGN-E546666
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194180Clone name: TUS-70-C10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102989 [cLHT-35-A12] Trace: SGN-T172027 EST: SGN-E358381 Direction: 5' Facility: TIGR
Clone: SGN-C194180 [TUS-70-C10] Trace: SGN-T347542 EST: SGN-E546667 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546666Length: 243 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E546666 [] (trimmed) GTCGAGTTTTTTTTCTACTATATATATGGAGTCAATTGAAGAACTGACTCTTTTCTGCATTTTGTATTACCAAATTCATCATTATGATAGTTGCT
ACAAGCAATTTGGCAATACAGCTAGCAATAAACAAAAGAAACTGTTTCCTAGTTAAAACAACACTGCGGAAACATAGGGGCTTGCGGCAACATGC
TTTTTATTATCCTCGCGAAACAGAGTGCTAGTTGAAATTTGGCAACGCTGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546666] SGN-U588625 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347541 [Download][View] Facility Assigned ID: TUS70C10_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5