Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E546935

Search information 
Request: 546935Match: SGN-E546935
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194336Clone name: TUS-70-I22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107232 [cLPP-4-L14] Trace: SGN-T175978 EST: SGN-E363541 Direction: 5' Facility: TIGR
Clone: SGN-C194336 [TUS-70-I22] Trace: SGN-T347809 EST: SGN-E546934 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E546935Length: 483 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E546935 [] (trimmed) GCTGAGTTTGATCCATATTTGGAAAAACAAGCTTTGGAAGCCCTCAACTCTTCACTTGAAGCATATACTAATAATCCTGAGGAAATAACTAATGC
ATTCAACAAAGAAGTTGGAAATGCATTGCTGAAGTATAAAAGCTTAAGGAGGCATCTTAAAGAAAAAGATAAATGCATGGCAACCAATCCAATTG
ATAGATGCTGGAGGTGTGACAAAAATTGGGCTGAAAACAGGATGGATTTGGAAGAGTGTGCTAGAGGATTTGGCCACAAGACGACCGGTGGTAAA
AATGGCAAGTACTATGTTGTCACTGATGAATCAGATGATGACGTGCAGGAACCAAAACCAGGGACCCTTCGTCATGCTGTGATTCAAGAGGAGCC
ATTGTGGATCATCTTTGAGAAACAATGGTGATCAAGTTGCAACCAGAACTTATGATCACGAGTGACAAGACNATCGATGGCAGGGGAGTCGCTGT
TCACATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E546935] SGN-U572165 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T347810 [Download][View] Facility Assigned ID: TUS70I22_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5