EST details — SGN-E547890

Search information 
Request: 547890Match: SGN-E547890
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188760Clone name: TUS-56-A14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47978 [cLEI-2-P9] Trace: SGN-T79828 EST: SGN-E265214 Direction: 5' Facility: TIGR
Clone: SGN-C188760 [TUS-56-A14] Trace: SGN-T338311 EST: SGN-E537436 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547890Length: 268 bp (968 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547890 [] (trimmed) TAAAATTATAAATACTATCAAACACTGGCAGCTCCATATAACCAAAATACTAAACCTTCCTTGATGAACAAAGAAGTAATTTCAGTTTAAAACCT
ACAGTTATCTCATATTCAACATTAGGAACATCAATTCACATATTACTTACGATATTTTTTTTTTTATACCCAGCAAATCTGGAAAATCATTCGTC
TCAGATGGCTTACATATATTCGTTCACCATACCATCAGGATTTCAGATCAAATGGAGACTGCTTGGCACATTCTAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547890] SGN-U581232 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348765 [Download][View] Facility Assigned ID: TUS56A14_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.879 Expected Error Rate: 0.0116 Quality Trim Threshold: 20.5