EST details — SGN-E548722
| Search information |
| Request: 548722 | Match: SGN-E548722 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C191750 | Clone name: TUS-63-N4 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C90201 [cLEW-20-C16] | Trace: SGN-T113868 | EST: SGN-E299607 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C191750 [TUS-63-N4] | Trace: SGN-T343361 | EST: SGN-E542486 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E548722 | Length: 204 bp (826 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E548722 [] (trimmed)
GGTTTACAGAGTGCTTACAAATTGGGGAAGAAGAAGAAGAAAGCTAAGAAGAGAAAATTTCAGTTGAAGGTAGCCATGAAAGGAGGAGGAAGGAA
GAATTTGAAAAGGGCTATTGAGGAAGACAATTTTACCCTTGAACAAGGTCAAAGCATTATGCAAGTTGTCGACCTTCGAGGTTCCAATCTTATTC
AAGTAATGGATGCA
GAATTTGAAAAGGGCTATTGAGGAAGACAATTTTACCCTTGAACAAGGTCAAAGCATTATGCAAGTTGTCGACCTTCGAGGTTCCAATCTTATTC
AAGTAATGGATGCA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E548722] | SGN-U584835 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T349597 [Download][View] | Facility Assigned ID: TUS63N04_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.912 | Expected Error Rate: 0.0010 | Quality Trim Threshold: 14.5 |
Working
