EST details — SGN-E548763

Search information 
Request: 548763Match: SGN-E548763
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191893Clone name: TUS-64-D3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90774 [cLEW-24-B12] Trace: SGN-T114500 EST: SGN-E301377 Direction: 5' Facility: TIGR
Clone: SGN-C191893 [TUS-64-D3] Trace: SGN-T343613 EST: SGN-E542738 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548763Length: 530 bp (896 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548763 [] (trimmed) GGTTTTACTTCTGGATTAGATGCCCTATTCATAACTAGGTTTGGATCCCAGCGTTCTGAGTATTGGCGAACTCTTTACTCCTCAGTTGTAAGTTT
CAACTAGCTGGAAGTCATTTTGGAAGTCCTAATATGTTATCCCTCCTAGTTGATTTATCCTGTTCCCCTGCAGAGTTTTGGGGCCCCTTTTCTCG
TTTTGTGCTCAGAAAATGATGATATTGCACCATATCAATCTGTATGTAAATTTGCTCACAGCTTGCAAGACATGGGGGCAGATATCAAAATGATA
ATGTGGAAGAGTTCCTGTCACGTAGGCATGTACAAGAGTGATCCCATCCAGTACAGCATTGCTATAGATCAACTACTTGCTCAGGCAACTTCAGT
TTTCTCTAGCAGAATTAGGAAACTAGGAGAGAGAAATGGCTTCGATGATATGCATGATGAAATATCTCACATGATTTGTGACCTCCAAAATGCAG
CAGCTGACTCGAATGGAGTTTTAGAAGAGTTGCAGGGGGACAAAGGATCACTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548763] SGN-U569772 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349638 [Download][View] Facility Assigned ID: TUS64D03_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5