EST details — SGN-E548972

Search information 
Request: 548972Match: SGN-E548972
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192634Clone name: TUS-66-B24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C97136 [cLEY-1-A3] Trace: SGN-T118398 EST: SGN-E302715 Direction: 3' Facility: TIGR
Clone: SGN-C192634 [TUS-66-B24] Trace: SGN-T344886 EST: SGN-E544011 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548972Length: 341 bp (887 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548972 [] (trimmed) GACAAGAACACTTCAAATACTCATTTCCCTTCCAACTCCACTCAATCATAGTGGAAAGTTTGATTGTATAACATTGTGTAGAAATGAAAAATGTG
AAAAGAATTAAAACAAAATCCTTAAATCCCCTCTCTAGTTCATCCGCCAAAGAAAAAATTTACCTAATCGATCCTTCAGAAATGGATGTGACCTT
GCAAACACCAACAGAAGTGGTGAGTGGCAAATCTTTATAGCAAGCAACCAACTCCTTATTTGTGTGCAGATCCACCTGAAGAGTTTCCCAAACCT
TCTTCTTAGGATTCAAGACATCATCCGCCTTGCCATCTAACCCAGGGAACATAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548972] SGN-U564301 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349847 [Download][View] Facility Assigned ID: TUS66B24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0028 Quality Trim Threshold: 12.5