Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E549782

Search information 
Request: 549782Match: SGN-E549782
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169837Clone name: TUS-6-M3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22104 [cLED-36-I3] Trace: SGN-T57763 EST: SGN-E241593 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549782Length: 262 bp (781 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E549782 [] (trimmed) TGCAGGAGCTTTACGATTTGCACCAGAAATCCAGTCCTTTGTGGCTATGAATATGCAAGGGAATGCTAGAACGCAACAAAACAACGCTCTACTAA
TGCATATGTCTCAACAACAACAACAATCGTCTAGGGCTCAAATGCTAAATGAAACCAATAATGGTCACGCTTCAAGGCCGCCATTGTCCATGTCA
CAACCTGCTGCAGTCTTATCACGAAATAGCATTGTTGACAACGTACGAGGGCCAATTTACAATCCAGTCTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549782] SGN-U581777 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350657 [Download][View] Facility Assigned ID: AGT-288_B07_TUS6#3E3.T3_058
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5