EST details — SGN-E549999

Search information 
Request: 549999Match: SGN-E549999
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169544Clone name: TUS-5-P22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C21188 [cLED-31-P22] Trace: SGN-T56917 EST: SGN-E242998 Direction: 5' Facility: TIGR
Clone: SGN-C169544 [TUS-5-P22] Trace: SGN-T351099 EST: SGN-E550224 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549999Length: 342 bp (820 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549999 [] (trimmed) CGCACCAGGACAACCTGCAATATTGAGTTTGGAGTACTCAAAAACTGAAAAAAAATTCTGCTTCCTTTTATAAGTCTTCATTGAATTCAACTTTA
AAATAATATTGGTGGATATCTCTGCTACACAGAGTGGCAATGGATCTTCAACTACTCGTTGACCCTTGGTGTGGTCTATGTACAATAGCTCATAC
ATAAGTTGGCTAGATTTTCAACAATGCACCATCACTAGTGAATGTGTTTGTAAAGATAACCTTTTACTAGCTAAGCTAGAACAAGTGTTTGTGAA
ATGTGCAGATTGTTGAATATTGTTGGGCGCAATTGGTTGCTCACAACTTTAAACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549999] SGN-U563404 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350874 [Download][View] Facility Assigned ID: AGT-277_H10_TUS5#4-H10.T3_090
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5