EST details — SGN-E550056

Search information 
Request: 550056Match: SGN-E550056
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169488Clone name: TUS-5-N14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C20960 [cLED-31-D20] Trace: SGN-T56883 EST: SGN-E242964 Direction: 5' Facility: TIGR
Clone: SGN-C169488 [TUS-5-N14] Trace: SGN-T350849 EST: SGN-E549974 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550056Length: 372 bp (786 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550056 [] (trimmed) AAAAAAAAACAAAGAAAGAAAAAGTGCAACATATTTCTCCTTTCTGAAATTCTTAACCCGCCCTCATCAGTCTGCCTTTCGTCGTAGAGTCGCAA
AAAGTGAAATTTATTAAGTAGAGCCTTAGAGTTATTTTGTGATTGAGGCAACGTACTTGCCTTGATGAAATGCTTGTTCCAATTCAAGTTGTGTT
GGTTGTCTAGAACCATCACCAGCAAAAGTTCCAAAACCATAGGGACTTCCACCTTTAATATTCTCCATCTCAAACATTCCTGCTCCAAATGAATA
GCCAGTTGGTACAAACAACATTCCATGATGTACAAGTTGTGTTATCGCTGTCAACCCGTAAAAATAATAACACATTTTTTGTTACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550056] SGN-U565329 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350931 [Download][View] Facility Assigned ID: AGT-279_D01_TUS5#4-F2.Td_012
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5