EST details — SGN-E550340

Search information 
Request: 550340Match: SGN-E550340
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169362Clone name: TUS-5-I8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17789 [cLED-20-M11] Trace: SGN-T53707 EST: SGN-E236190 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550340Length: 493 bp (769 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550340 [] (trimmed) ATGCAATAGCATCATTTACGATCTATCTAGGGAAAGTAGAAAGCCAAGCAACTTTGTGTACTAACGAAATAGAAAATTTTGCTAAATTATGCGCT
ACTAAATTTCAAGACTTTTGAATATACACAGACATTAACCACTTCAAAGTACTTCATAAAGTTCCAAATATCTTTACAAGTAGTCTCTATCTCCC
ATGAGACTATAGTTCATTGTAGTACCATATCCACCACATTTTTTTTTTGCGTCTGATGAGATTTGCACCTTTGACCACCCCTTTTCTCTAGCATT
TTCCATCGCCATACGAATCGCAATCGCTTCAGCAGTGATGACTTTCCCAACATATTGAATCGGGGTGCCAAAAGCATGAAGCAGGTTACCATAGC
TATCCGAAGCCGCCACATCAATGCTTGCAGCCTTCTTTTCCTTATGTACACTAGCATCTACTAACATAGCAATACCATCTTGTGCCACAGTTAGA
TTTCTATCATCATTACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550340] SGN-U571961 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351215 [Download][View] Facility Assigned ID: AGT-276_A08_TUS5#3-A8.Td_055
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5