EST details — SGN-E551034

Search information 
Request: 551034Match: SGN-E551034
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188332Clone name: TUS-54-O18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C39089 [cLEG-48-I9] Trace: SGN-T73801 EST: SGN-E257929 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551034Length: 384 bp (683 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551034 [] (trimmed) GTGAAATTGATGCACCATTATCTCCCAGGAATAATTTATGTCTCATTGTGGTGGAATCCGATCTAAATAATGAAACGTCTTTTCTAAAACTTGAC
ATGATTTTGACTCAATATTTAGAGACATTGTCAAAACGGAGGAAGTATCATATGGGTAATCCAACAAACATGCATTATGAGCATCATGCCACTTT
AGCCCCAATTTTGCAATTTCATTTGAACAATTTTGGAGACACCTTTGCTCACCACCCTACAGATTTTCATTCAAAAGATTTTGAACTGGCTGTAT
TAGATTGGTTTGCACAACTCTGGGAAATACAGAATTATGAATATTGGGGATACATTACTAGTGGTGGCACTGAGGGCAATCTCCATGGCCTTTTG
GTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551034] SGN-U578845 Tomato 200607 Build 2 253 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351909 [Download][View] Facility Assigned ID: TUS54O18_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.810 Expected Error Rate: 0.0120 Quality Trim Threshold: 20.5