EST details — SGN-C62237

Search information 
Request: 62237Match: SGN-C62237
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C62237Clone name: cLEM-1-O23
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177809 is on microarray TOM1: SGN-S1-1-2.1.6.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177809 [TUS-27-I7] Trace: SGN-T182870 EST: SGN-E371362 Direction: 3' Facility: INRA
Clone: SGN-C177809 [TUS-27-I7] Trace: SGN-T182871 EST: SGN-E371363 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270275Length: 276 bp (1146 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270275 [] (trimmed) AGGATCTTCTTCTTCTTGCTCTACCATTACTGATACAAATAACCCCCCTGCAAGTACAAGCTGCTGCAACTGTCAAATTTCTTCCTGGATTTGAC
GGTCCTCTTCCTTTTCATCTCGAAACTGGGTATGTAGGTGTGGGTAAAGAAGAGAAACACCAGCTATTTTATTATTTTATTAAATCAGAATCAGA
CCCTGGAAATGATCCTCTTATATTGTGGCTCACTGGAGGACCTGGTTGCTCTTCTTTCAATGGAGTTGTCTATGAAATTGGACCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270275] SGN-U576877 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83648 [Download][View] Facility Assigned ID: TGFAA96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0034 Quality Trim Threshold: 20.5