Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C6313

Search information 
Request: 6313Match: SGN-C6313
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6313Clone name: cLEC-35-A9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173881 is on microarray TOM1: SGN-S1-1-2.1.17.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210248Length: 365 bp (2072 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E210248 [] (trimmed) CCCCCGGCCTGCAGGAATCCGGCCCAAGCAAAATCTCTCTTTTCTTTCATGGCTATGGCGATTCCTTCAAATTCCTTCTAAGAGTAGTGTGAAAA
ACCCTAATTAATCTTCTTCGAAGCTTCTAGAAACCTTCTAATGGCGTTCTGGTGGCCGTTGATTGTTATCGCTATCGCATTTGCGATCTGTAAAT
TACTGTTGATGCTCATTCCTGACAATGTCCCTTCCATTGATGTCGACACTTCTGATGTGTTGGATGATGGGAATCAGACTAAAGACAACAGTTTC
ATTTATATTCCCTCGAGAAGGCATACGGACAAAGTTCAGTGCTATGAACCAGCAACAATGAAGTACCTGGGTTATTTTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210248] SGN-U576701 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30596 [Download][View] Facility Assigned ID: TCAFG05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0147 Quality Trim Threshold: 14.5