EST details — SGN-C6397

Search information 
Request: 6397Match: SGN-C6397
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6397Clone name: cLEC-35-E6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173922 is on microarray TOM1: SGN-S1-1-1.3.18.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210459Length: 366 bp (871 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E210459 [] (trimmed) CTAAAGCTCACGCGTGGGTTAAAACTAACGTCCAAGCTTATTTACCGGCGACGAAAATCACTTGCATCGCCGTTGGAAATGAAGTGTTAACGTTT
AACAATACTGCACTTTCCGATAATCTATTACCGGCGATGGAAAATGTTCACGCCGCTCTTGTTAGTGTGAACTTAGATAAACAAGTGAGAGTTAC
TACTGCACATTCAGATGCCATTCTCGAGACTGCGCACCCGCCGTCTTCCGGAACTGTCCGTGGAGATCTTGACAGATGTGTGACTCAGGTGGCGG
ATTACCATTGTAAAACTGGTTCGCCGTTTCTAATCAATGCTTATCCTTATTTTGCGTATAAGGCAGATCCAACGCCGGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210459] SGN-U568475 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30807 [Download][View] Facility Assigned ID: TCAFH27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0255 Quality Trim Threshold: 14.5