EST details — SGN-E641303

Search information 
Request: 641303Match: SGN-E641303
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C438674Clone name: cccs30w7e20
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C438674 [cccs30w7e20] Trace: SGN-T462537 EST: SGN-E627860 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E641303Length: 468 bp (596 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E641303 [] (trimmed) GGAAAGCTGAGGGCTCAACGTGCTAAGTCTATGAAATTCAAAGATGGTTACATGATCTCTTCTGGACAGCCAGTCAAGGAATATATCGATTCTGC
TGTCAGACACGTTCTTTTGAGGCAGGGCGTACTTGGTATCAAGGTAAAGATTATGCTATCTTGGGATCCGAAGGGAAAGATGGGGCCAACAACTC
CCCTCCCTGATCTTGTCACAATTCATCCCCCCAAGGAGGAGGAAGACTACATCAGGCCGACACTGGTGGCATCTGAGATTGAGGTCCTTGCATAA
AGCAACATTTGCTGTCTCCTGTGACGGTTGCTGATGTTATATTTATTCAAATATTTTTAAGGATTCTTTTGGTGAAAATTAATATGCTAGGTGAT
GTAGAACGCGCCTTGACAAAATTTTTGACTGTAGAGCCTGAGTTTTGTTCAACTGTATCTTCAAAGAGATTTTGTTTTCTACCCTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E641303] SGN-U614784 Coffea canephora Build 3 2 ESTs assembled
[SGN-E641303] SGN-U637668 Coffee species Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T465879 [Download][View] Facility Assigned ID: cccs30w7e20_1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15