EST details — SGN-C64197

Search information 
Request: 64197Match: SGN-C64197
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64197Clone name: cLEM-5-G23
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C183145 is on microarray TOM1: SGN-S1-1-2.3.3.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183145 [TUS-41-G15] Trace: SGN-T191490 EST: SGN-E390164 Direction: 5' Facility: INRA
Clone: SGN-C183145 [TUS-41-G15] Trace: SGN-T191701 EST: SGN-E390375 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271356Length: 485 bp (1024 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271356 [] (trimmed) GCCCACTTTGGAATTTTCTTTACCTTACCTAAGAAGGGTATTAATTTGATTCTTGTGGGAAGGAAGAAGGATCAAGAATGGCGATTTCGATTTCT
GCTATGAGTTTTGGAACCTCAGTTTCTTCACATTCTTGTTTTAGAGCTAGGAGTTTTGAGAAGTCATCAGTTTTATGCAATTCCCAGAACCCATG
TCGGTTTAATTCTGTTTTTCCGATTCGGAAATCTGATGGGGCTTCACGGTGTTCTGTTTCTAGGAAATCATGTAGAGTTCGAGCAACGTTGTTAC
AAGAGAATGAAGAAGAAGTGGTTGTGGAGAAATCTTTTGCACCTAAGAGTTTTCCTGATAACGTGGGAGGGGGAAGTAATGGGAAGCCACCAGAT
GATTCATCCTCTAACGGTCTAGAGAAATGGGTTATAAAGCTTGAGCAGTCTGTAAATATCTTACTCACGGATTCAGTGATAAAGATTCTTGACAC
TTTGTATCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271356] SGN-U582562 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85161 [Download][View] Facility Assigned ID: TGFAQ48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5