EST details — SGN-C64229

Search information 
Request: 64229Match: SGN-C64229
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64229Clone name: cLEM-5-I16
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177907 is on microarray TOM1: SGN-S1-1-8.1.6.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177907 [TUS-27-M9] Trace: SGN-T182812 EST: SGN-E371304 Direction: 3' Facility: INRA
Clone: SGN-C177907 [TUS-27-M9] Trace: SGN-T182813 EST: SGN-E371305 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271404Length: 498 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271404 [] (trimmed) GCCCCCCCCTTTTTTTTTCTCTGTTTGAATTCATCTCTGGTTTCTCTTTTATAGAGAGAAATTTGAATCCCCATTTGCATTGTAATGGCGACCAT
GTCATTCGTTGGAAGACTTCTCTTCGTATCCGTCTTTGTTCTCTCCGCTTATCAAGAGTTCAGTGAATTTGGGTCTGATGGCGGGCCAGCAGCAA
AGGCTTTAGCACCAAAGTTCAATGTTTTGTCAAAGCATGTGGCAACACACATCGGATTTGAATTACCCCATGTAGAGATGAAACATCTTATTTTG
GGGGCCATAGTTTTGAAGGGTCTTGGAAGCCTTTTATTCGTCTTCGGCAGCACTCTTGGAGCTCTTCTTCTGCTGATACATCAGGCCGTTGCTTC
CCCAGTTTTGTACGACTTCTACAACTATGATGTTGACAAGAAGGAATTCGTTCAACTCTTTTTCAAATTTTCTCAGAACTTGGCGTTGCTAGGTG
CACTATTGTTTTTCATTGGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271404] SGN-U578722 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85209 [Download][View] Facility Assigned ID: TGFAR56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5