EST details — SGN-C64398

Search information 
Request: 64398Match: SGN-C64398
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64398Clone name: cLEM-6-A2
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178003 is on microarray TOM1: SGN-S1-1-8.1.4.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178003 [TUS-28-A9] Trace: SGN-T183263 EST: SGN-E370336 Direction: 3' Facility: INRA
Clone: SGN-C178003 [TUS-28-A9] Trace: SGN-T183264 EST: SGN-E370337 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270818Length: 283 bp (402 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270818 [] (trimmed) GCAATAATATGACCACTAAAAAGGATGAGCTTCTATTCTCTGCTATGAAGAGGACCTCTGACTGGATTTTCTCCCAAGAGATTCCCAGTGATGTA
ACTGTAAATGCAGGAGGAACCTCCTTTACACTGCACAAGTTCCCATTAGTTTCAAAGAGTGGATACATAAGAAAGTGGATCTCAGAATCTAATGA
GGCTGATGTTTCTACTATCAATATCCCTGATATACCTGGTGGAGGAGAGGCATTTGAACTTGCAGCAAAGTTTTGTTATGGAATAAATTTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270818] SGN-U574291 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84574 [Download][View] Facility Assigned ID: TGFAV01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5