EST details — SGN-C64507

Search information 
Request: 64507Match: SGN-C64507
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64507Clone name: cLEM-6-F21
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178075 is on microarray TOM1: SGN-S1-1-8.4.4.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178075 [TUS-28-D9] Trace: SGN-T183472 EST: SGN-E371112 Direction: 3' Facility: INRA
Clone: SGN-C178075 [TUS-28-D9] Trace: SGN-T183473 EST: SGN-E371113 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270884Length: 496 bp (963 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270884 [] (trimmed) GAGTGCCAGTTTTTCTGTTATTTGTTAGTAGTACTTCCGATCTTTGTATCAAAGTCTGATTAAGTAGGAAGAGTAAAATGAAAGAAGAAACTAAA
TTGAGCTGTTGATTTGCATCGAATTGAGTATGGCAACTGCTCTAGTAAAGTTTGTTCAAATGACATTAACTTATAGATCTTCTGAGATTGGAGAT
CATTAAGAGGTGTCTTTGGAAGCCGATAAAGTAAAAAATGTGACCCCTAGATATGCTAAACTAAGAGCAGATGCAAATGGTTCTGCCAAAGGACA
AATTATTGGGTGGCAGAATATTGAGCTCATTAGTGATCGACCTCTGGAAACAATGCTGAAAGAGTTTAAGCAATTGAAAGAAGAGTATCCAGATA
GGATACTAATTGCTTCTATCATGGAAGAATATAACAAAGCTGCTTGGGAGGAACTTATTTACAGATGTGAGGAAACTGGAATTGATGCCTTTGAA
ATCAACTTCTCGTGTCCCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270884] SGN-U579470 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84640 [Download][View] Facility Assigned ID: TGFAW35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5