EST details — SGN-C64564

Search information 
Request: 64564Match: SGN-C64564
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64564Clone name: cLEM-6-I10
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178113 is on microarray TOM1: SGN-S1-1-2.1.4.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178113 [TUS-28-E23] Trace: SGN-T183288 EST: SGN-E370361 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270680Length: 298 bp (410 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E270680 [] (trimmed) GAATTTCTGTTGAGTTTTATATATATCTCTTCATTTTACACTAAGCTTGATCATTTCCTTCAAGATTTCAATATTCACTTAGAAATTGAATTGAT
CTAGAAATGGCTTCCAATGGAGATAACAATGCTTCTGCAAAACCTCCTCCAGAACCATCGCCATTGCGCAAAGCAAAATTTTTCCAGGCTAACAT
GAGAATTTTGGTGACGGGTGGTGCTGGATTTATTGGCTCTCACCTCGTTGACAGACTGATGCAAAATGAGAAGAATGAGGTGATTGTTGTGGATA
ACTACTTCACTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270680] SGN-U566530 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84436 [Download][View] Facility Assigned ID: TGFAV53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5