EST details — SGN-C66973

Search information 
Request: 66973Match: SGN-C66973
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C66973Clone name: cLEN-17-A12
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C181049 is on microarray TOM1: SGN-S1-1-2.4.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181049 [TUS-35-P7] Trace: SGN-T196426 EST: SGN-E395100 Direction: 5' Facility: INRA
Clone: SGN-C181049 [TUS-35-P7] Trace: SGN-T197735 EST: SGN-E396409 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276528Length: 539 bp (930 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276528 [] (trimmed) TTCAAGTCTGCCAGGGACAGTTCTGGTCATGGAAGTCATACAGCTTCAACTGCTGCTGGGCGTTATGTAGCTGATATGAATTACAAAGGTTTGGC
ATCTGGAGGAGCCAGAGGTGGTGCCCCAATGGCCAGGATAGCAGTGTACAAAACCTGCTGGAGTTCTGGTTGCTATGATGTTGATTTGTTGGCTG
CATTTGATGATGCAATTAGAGATGGGGTTCATGTCATTTCTATATCTTTGGGCCCAGATGCTCCCCAAGGAGATTATTTTAGTGATGCAATTTCT
GTGGGGTCATTTCATGCTGTTAGCCGTGGGATACTTGTAGTGGCCTCCGTTGGAAATGAAGGAACCTCTGGTTCAGCCACAAATTTAGCTCCTTG
GATGATCACAGTTGCAGCCAGTTCAACCGATAGAGATTTTACATCTGATGTTTTACTAGGAAATAGAGTTCAACTCACGGGTGAAAGTCTTAGCT
TATCTCAAATGCATACATCTGCAAAAATCATACCTGCTTCTGAAGCTTATGCTGGATACTTCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276528] SGN-U566126 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90949 [Download][View] Facility Assigned ID: TRRCN06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5