EST details — SGN-C67219

Search information 
Request: 67219Match: SGN-C67219
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C67219Clone name: cLEN-17-N4
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183017 is on microarray TOM1: SGN-S1-1-2.2.3.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195163 EST: SGN-E393837 Direction: 3' Facility: INRA
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195332 EST: SGN-E394006 Direction: 5' Facility: INRA
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195616 EST: SGN-E398837 Direction: 5' Facility: INRA
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195807 EST: SGN-E394481 Direction: 3' Facility: INRA
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195807 EST: SGN-E399505 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276620Length: 560 bp (893 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276620 [] (trimmed) GAACTCATGCAATGCTCTTCTTCTCAAGGTTAATCAGATTGGTACAGTGACGGAAGCCATTGAAGTTGTCAAGATGGCCAAGGATGCCCAATGGG
GGGTTGTGATATCTCAAAGACTTGGTGAAACTGAAGACAGTTTCATATCTGATTTATCTGTTGGCTTAGCTACTAGTCAAATTAAAGCTGGTGCC
CCTTGCCGAGGAGAACGACTTGCAAAGTACAACCAGTTGCTTAGAATTGAAGAAGAGCTTGGTGATCAAGCAGTTTATACTGGTGAAAAGTGGAG
GAACTGATCTTTTTTTCATCAGAATTCTGGTTTTGGACCATTCCATTTAGCAGTGGCACTATCTCTTTCAGTTTGCAGCACAACAACTACAGTTC
TGAACATTCTTCCCACTGTGCATTACACTTGAAAATGCTACAGTGTCTTCTAGCTTTGTACTAATGATTGCGGTTTGCGAGATGAGCTTGTTTGT
TCTATGTACTAGTATTTACATCTAAATTTTTTCTGTATCTAGGTACATTTGTAGATCAACTTGAAGAGCAATCATAAATTAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276620] SGN-U574678 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91041 [Download][View] Facility Assigned ID: TRRCP74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0111 Quality Trim Threshold: 12.5