EST details — SGN-C6861

Search information 
Request: 6861Match: SGN-C6861
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6861Clone name: cLEC-37-B14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183535 is on microarray TOM1: SGN-S1-1-4.3.1.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T194936 EST: SGN-E393610 Direction: 3' Facility: INRA
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T194936 EST: SGN-E399558 Direction: 3' Facility: INRA
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T194937 EST: SGN-E393611 Direction: 5' Facility: INRA
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T195489 EST: SGN-E394163 Direction: 3' Facility: INRA
Clone: SGN-C183535 [TUS-42-G21] Trace: SGN-T195954 EST: SGN-E399158 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208434Length: 484 bp (947 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208434 [] (trimmed) GCTAACAAAGCTAGAGCAAAGCTCATTGTTGTCCTGACACGTGGCGGGAGTACAGCAAAGCTGGTTGCCAAGTATAGGCCTGCAGTTCCTATTCT
GTCAGTAGTCGTGCCTGTTTTGACTACAGACTCTTTCGATTGGTCCATCAGTGACGAGACCCCAGCTAGACACAGTTTGGTATATAGGGGCTTGA
TTCCACTTCTTGGTGAAGGTTCCGCAAAGGCCACTGATTCTGAATCAACTGAGGTAATCCTTGAAGCTTCCCTGAAGTCTGCTGTAACGAAAGGG
CTATGCAAACCTGGTGATGCTGTCGTTGCACTTCATCGTATTGGTTCTGCATCCGTTATCAAGATTTGCATCGTGAAGTAATCGTCATGTCACGT
AACATACAATTCTTGAACTCCCCCACACCTGAGCTCAGACTGATTTTCATTTATGCTTTTCTGGTCTTGATTATGCATTATCAATATGCTGATTA
TGTCACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208434] SGN-U565588 Tomato 200607 Build 2 113 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31425 [Download][View] Facility Assigned ID: TCAFR07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5