EST details — SGN-C68710

Search information 
Request: 68710Match: SGN-C68710
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C68710Clone name: cLEN-7-H7
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183518 is on microarray TOM1: SGN-S1-1-5.3.2.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183518 [TUS-42-G4] Trace: SGN-T196021 EST: SGN-E399574 Direction: 5' Facility: INRA
Clone: SGN-C183518 [TUS-42-G4] Trace: SGN-T196133 EST: SGN-E394807 Direction: 3' Facility: INRA
Clone: SGN-C183518 [TUS-42-G4] Trace: SGN-T200293 EST: SGN-E399255 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273917Length: 542 bp (740 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E273917 [] (trimmed) TCTAAATTATCGATAGATTTATTGTTTCAGATGGAGGAGGAGAAACACCACCACCACCACCTGTTCCACCACAAGGACAAGGCGGAGGAGGGCCC
CGTCGACTACGAAAAAGAAATCAAACACCATAAACATCTCGAGCAAATCGGTAAACTTGGCACTGTTGCTGCCGGTGCCTACGCCTTGCATGAGA
AACATGAGGCAAAGAAAGATCCAGAACATGCACACAAACACAAGATAGAGGAAGAGATAGCAGCAGCTGCTGCAGTTGGGGCAGGTGGATTTGCA
TTCCATGAGCATCATGAGAAAAAAGATGCCAAGAAAGAAGAAAAAAAAGCTGAGGGGGGACACCACCATCTCTTCTAAATTGTTATTTTAGTTAC
ATTTTTAATATTCGTGGAATTTCCATATTTGGTATAAGTGTTGTGTCATCTTATCATATATCGTGCATAATAACAATAAATTTAGTGTGATATTA
TAAATGGATCGAGTTAAAAAAAAAGAGCAAAAGTCAAAATATATTTTACCAATCTCGTGTGATGTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273917] SGN-U581076 Tomato 200607 Build 2 416 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88613 [Download][View] Facility Assigned ID: TRRBA40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5