Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C6897

Search information 
Request: 6897Match: SGN-C6897
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6897Clone name: cLEC-37-D13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181946 is on microarray TOM1: SGN-S1-1-1.1.10.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181946 [TUS-38-E16] Trace: SGN-T194578 EST: SGN-E393252 Direction: 5' Facility: INRA
Clone: SGN-C181946 [TUS-38-E16] Trace: SGN-T194792 EST: SGN-E393466 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208233Length: 595 bp (693 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208233 [] (trimmed) AGATGGCGATCATCTTGGTGCTGTTAGCAAAGTTTATACCCCAGCTAATCAAGGTGTTGAAGGTTCGATATGGCAATTGGCTAAAGCTTATGTTG
CAGTGAATGACTCCGGTGTTCATCAGCTAATTAGTCACTGGTTGAATACACATGCAGCCATTGAGCCGTTCGTGATTGCAACAAACAGGCAACTA
AGTGTGCTTCACCCAATTCATAAGCTTTTACATCCTCATTTTCGTGACACGATGAACATAAATGCTTTGGCAAGACAGATCTTAATCAATGCTGG
TGGAGTTCTTGAGATGACAGTTTTTCCTGCCAAATATGCGATGGAAATGTCAGCTGTAGTTTACAAAAGTTGGGTTTTTCCTGAACAAGCACTTC
CAGCAGATCTTATTAAGAGGTATAAATTATAATTTAGAACCAAATTTACTAGAAAAATATGGTTGTTGTTGAAGTTTAAATTCCAGGTGTTTTGA
TTTTGCTAATATGAACTATAATATCATTTGATTTTAGAGGAGTGGCCGTAGAGGACTCAAGTTCCCCACATGGTGTTCGCTTGCTAATTCAAGAC
TATCCTTATGCTGTTGATGGCTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208233] SGN-U590948 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31224 [Download][View] Facility Assigned ID: TCAFQ19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5