Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E691057

Search information 
Request: 691057Match: SGN-E691057
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468063Clone name: LH_Ea05B23
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468063 [LH_Ea05B23] Trace: SGN-T492978 EST: SGN-E694897 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691057Length: 214 bp (981 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E691057 [] (trimmed) CCGTTATAGTTCAAAACCCCTAGATGCACTAGCAACAAAGTGCCATTAAATATCCTTAATGTTTGTACCATTAAGAGGTTTTATAGCACAGCTTA
TGGGTAGTAAATTAGAATAATGTGGTGATTATGTATTCACGAATGATATCTTAATTTATGTGATATATTTTTAATTGTAGTTTAAATAACTTGAA
TTTTAAAACCAACCAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691057] SGN-U567091 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T496259 [Download][View] Facility Assigned ID: LH_Ea05B23.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.895 Expected Error Rate: 0.0107 Quality Trim Threshold: 12.5