Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E691690

Search information 
Request: 691690Match: SGN-E691690
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468696Clone name: LH_Ea06M08
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468696 [LH_Ea06M08] Trace: SGN-T491885 EST: SGN-E695530 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691690Length: 308 bp (1174 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E691690 [] (trimmed) TCGTTAAAGGGAAGAATCTATGGTTAAAGGCCCCTCCGACGCCTTACATTGCAACATACCACCTCCATTGAGTCCTGCAGATGTTCACTCTCTTC
TTGTTACAAAAGAAAAATTGATCAAACAAGTTGAATCATGGGAACAACAATACTGGAATAAGAACAAAACCAAACAACATTGAATATTTTAGTAG
TTTTTTTTTTCATATTCATTTGTCAAAGGTTCATTTTGCTATTCAATGACAAATTTTTGAATCAATAAACTATTAATTTTGGTTTAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691690] SGN-U596697 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T495738 [Download][View] Facility Assigned ID: LH_Ea06M08.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.893 Expected Error Rate: 0.0072 Quality Trim Threshold: 12.5