Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C69335

Search information 
Request: 69335Match: SGN-C69335
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69335Clone name: cLEN-9-M9
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180771 is on microarray TOM1: SGN-S1-1-8.4.17.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180771 [TUS-35-D17] Trace: SGN-T1645 EST: SGN-E378711 Direction: 5' Facility: Giov. Lab
Clone: SGN-C180771 [TUS-35-D17] Trace: SGN-T196376 EST: SGN-E395050 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275087Length: 474 bp (858 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E275087 [] (trimmed) TCATATTGAGATTTTTAGAAATTATTCTAATCATTCACAGTGCAAAAGAAGATGGAAAGCCCTAGAGTTGAGGAGAGTTATGACAAAATGAGTGA
ATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACTAAAGTACCTCAAATATTCGTTCTACCGCCAAAAG
ACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGATGAGGATCCGATTAAGCATAAGGAGATAGTGGAC
AAAGTTCGAGATGCATCGGAGAAATGGGGTTTTTTTCCAAGTGGTTAATCATGGGATTCCAACATCCGTCTTGGACAGAACGTTGCAAGGAACAC
GACAGTTCTTTGAGCAAGATAACGAGGTTAAGAAACAGTATTACACTCGAGATACTGCGAAAAAAGTGGTTTATACTAGCAATCTTGATTTGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275087] SGN-U580508 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88959 [Download][View] Facility Assigned ID: TRRBG77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5