Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C69397

Search information 
Request: 69397Match: SGN-C69397
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69397Clone name: cLER-10-B20
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184373 is on microarray TOM1: SGN-S1-1-6.2.16.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184373 [TUS-44-J19] Trace: SGN-T198303 EST: SGN-E396977 Direction: 3' Facility: INRA
Clone: SGN-C184373 [TUS-44-J19] Trace: SGN-T199980 EST: SGN-E398654 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278598Length: 467 bp (725 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278598 [] (trimmed) TAAAGGTCCTGACAGAAACTAATGGTGACGGAGAAGATTATATAAATGAGGTAGCCAGTATAAGCAGAACTTCCCATGTTAACATAGTAGGGCTT
TTGGGATTTTGTTACCAAAGGAATAGGAGAGCCTTAATCTATGAGTATGTGTCCAACGGTTCACTGGACAAATTTCTTAACAGTGGACCATCTAG
CACAACTTGTTCCTTGAAATGGACAACATTGTACAGTATCGCAGTTGGGACTGCTCGAGGTTTGGAATATTTACACCGAGGTTGCAACACAAGAA
TAGTCCACTTTGACATAAAACCTCACAACATTCTCTTGGACCAGGATTTCTGCCCCAAAATATCTGACTTTGGCCTCTCTAGATTGTGCGAGAAA
AAGGAGAGCATTCTATCAATGTTAGGTGCCAGGGGAACGGCTGGATACATTGCTTCAGAAGTGTTCTCTAGAGCATTTGGGCACGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278598] SGN-U599379 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94025 [Download][View] Facility Assigned ID: TPRBN10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5