Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E695594

Search information 
Request: 695594Match: SGN-E695594
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468760Clone name: LH_Ea06O24
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468760 [LH_Ea06O24] Trace: SGN-T495674 EST: SGN-E691754 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E695594Length: 174 bp (1006 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E695594 [] (trimmed) AGATTGGGGTTTTATTGGAGAAATCTTAACTCAATTGATTAAAACTGATTGTTGTTGAATTGCCTTTACTTGAAAGTTGGCATTGGATACCCTTG
TTCGATCAGAAGTATCTCGACCATTTTCTTTCTTTAGCAGAATACTTGGAGGTGCCCTCTTGCCGAATTCCGCACGAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E695594] SGN-U564101 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491874 [Download][View] Facility Assigned ID: LH_Ea06O24.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0254 Quality Trim Threshold: 14.5