EST details — SGN-C69859

Search information 
Request: 69859Match: SGN-C69859
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69859Clone name: cLER-12-N11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183526 is on microarray TOM1: SGN-S1-1-5.3.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183526 [TUS-42-G12] Trace: SGN-T200455 EST: SGN-E399575 Direction: 3' Facility: INRA
Clone: SGN-C183526 [TUS-42-G12] Trace: SGN-T200297 EST: SGN-E399262 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283308Length: 194 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283308 [] (trimmed) CCGGGCTGCAGGGTATAATTACCGTATTTATAGTTTTTAACAATGGCTGCTGCTAATGGAGTATGACTTTCATGGCCATCAAAATTGACCAAAAA
TCAAACACCCAAGATGGGAGTTTTTCTCCATCTCACCGTCGATGCAACCCATCTTCTTCTTCTTCTTCTGCAACCATTAGAATGACAGCCTCAGT
TGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283308] SGN-U578264 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94275 [Download][View] Facility Assigned ID: TPRBU78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0177 Quality Trim Threshold: 14.5