EST details — SGN-C70662

Search information 
Request: 70662Match: SGN-C70662
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70662Clone name: cLER-15-I16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178780 is on microarray TOM1: SGN-S1-1-7.1.2.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178780 [TUS-30-A18] Trace: SGN-T184487 EST: SGN-E371873 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282655Length: 332 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282655 [] (trimmed) TTTATACGGTAACATTATTCAACCGTGATGCCGACAATTTCAAGAATAAGGCGCGTGAAAGAGGCTTCCAGATTCGTGATTTCGAACATAATCCA
GAGACTCAAGAAAGCCGGAAACAAGAGCTGGAAAAACTGATGCAAGATCAAGAGACATTCAGAAGCTCTCTGTTGCAGTGGTGCTATACCAGTTA
TGGGGAGGTCTTTAGCTCCTGGATGCACTTTTGTGCTGTGCGTATCTTTGCTGAGAGCATTTTGAGATACGGGTTGCCTCCATCATTTTTGTCTG
TTGTTTTGGCACCCTCAATCAAAAGTGAGAAGAAAGTACGTTCCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282655] SGN-U572299 Tomato 200607 Build 2 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95175 [Download][View] Facility Assigned ID: TPRCF56THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0110 Quality Trim Threshold: 12.5