Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C70667

Search information 
Request: 70667Match: SGN-C70667
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70667Clone name: cLER-15-I21
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178781 is on microarray TOM1: SGN-S1-1-6.1.2.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178781 [TUS-30-A19] Trace: SGN-T184411 EST: SGN-E371797 Direction: 3' Facility: INRA
Clone: SGN-C178781 [TUS-30-A19] Trace: SGN-T184412 EST: SGN-E371798 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282613Length: 507 bp (752 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282613 [] (trimmed) TTCCTCTAGGGTTTCAACACGATGCAACCGGCGGCAAGTTCAATGGTTCCACCACCAATGGCGGCGCAACCACAGTACCAACAGCAGTGGATGGC
TCAGCAGCCGCAGTACCAGGTTCTGCCACCGCAGGCCGGTTATTATTACCAACCACCACCGCAGCAAGGTGGCGGAGTACCCCCACCGCAGCAGC
AACAACAACAATCTCAGTACACGGCTTCAGCTCAGCCGACCAGTGCTGATGAAGTCCGGACGCTTTGGATTGGAGATCTACAGTTTTGGATGGAT
GAGCAGTACCTATATAGTTGCTTCGCGCAAACTGGAGAGGTGGTTTCCGCTAAAGTTATCCGCAACAAGCAAACTCAGCAATCAGAGGGTTATGG
CTTTATTGAGTTTAATAGTCATGCTGCTGCAGAAAGGAATCTACAAGCATACAATGGCACCTTGATGCCTAATATTGAGCAAAATTTTATGCTCA
ACTGGGCATCACTTGGTTCGGGTGAAAAGCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282613] SGN-U579676 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95133 [Download][View] Facility Assigned ID: TPRCE59THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5