EST details — SGN-C71261

Search information 
Request: 71261Match: SGN-C71261
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C71261Clone name: cLER-17-F4
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178865 is on microarray TOM1: SGN-S1-1-2.1.3.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178865 [TUS-30-E7] Trace: SGN-T184341 EST: SGN-E371727 Direction: 3' Facility: INRA
Clone: SGN-C178865 [TUS-30-E7] Trace: SGN-T184342 EST: SGN-E371728 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283212Length: 318 bp (852 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283212 [] (trimmed) GAAAGAAGCAAAGCTTATTCTATTACTATTCATAGTACATATAACCTTGGATTTACAAGAAAGACAACAATTAACAAATGTCAAGACTAATTAAT
TATACCTTTGGGAAGTAGCCAGTAAATATAAAAGCAAATTGGTGGCACTGCATTAATGCGCACCAATACACAGCTCTTGAAGGGCTAGTGATGAT
ATGGCATGTGAGTATATGACCCTTCTATCTCCATGATAAAGGACGGGGCGATCACACGGATGGGAAATACTTGTTGAGATTGAATGGGAGGGAAT
AGAATTCCTCACTTCTCGTGTCCGTCTTGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283212] SGN-U564503 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96063 [Download][View] Facility Assigned ID: TPRCP26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5