EST details — SGN-C71386

Search information 
Request: 71386Match: SGN-C71386
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C71386Clone name: cLER-17-L15
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178905 is on microarray TOM1: SGN-S1-1-2.2.2.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178905 [TUS-30-F23] Trace: SGN-T184763 EST: SGN-E372323 Direction: 3' Facility: INRA
Clone: SGN-C178905 [TUS-30-F23] Trace: SGN-T184764 EST: SGN-E372324 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283192Length: 554 bp (800 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283192 [] (trimmed) TTTCAGTGCCAAACCCAATTAGTCCGGACGACGCAAATCACAGCGATTTCTTCAAAACCTATCTGGAAAAATGGCATCAGTTGATGTTGAGAAGA
GGAGGAGCGATATGGAGAGAGAGGAAGCCTGTTCGGCCAAACCAACAAAGCAAGGGGAAGGGCTGAGACAGTACTATATGCAGCACATCCATGAT
CTCCAGCTCCAAGTCCGCGTAAAGACTCACAATCTTAATCGCCTTGAAGCCCAGAGGAACGAACTCAATTCTAAAGTGAGAATGCTAAAAGAGGA
ATTACAATTGCTTCAGGAGCCTGGATCATATGTTGGTGAAGTTGTTAAAGTAATGGGGAAGTCAAAGGTTCTAGTCAAAGTTCATCCTGAAGGCA
AATATGTTGTTGATATTGGCAAAAACATTGACATTACAAAGATCACTCCATCAACTAGAGTTGCCCTGCGCAATGATAGCTATGTTCTTCATCTA
ATTTTGCCCAGCAAAGTTGATCCATTGGTCAACCTCATGAAAGTTGAGAAAGTGCCAGATTCCACTTATGACATGATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283192] SGN-U580275 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96043 [Download][View] Facility Assigned ID: TPRCO68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5