EST details — SGN-C71776

Search information 
Request: 71776Match: SGN-C71776
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C71776Clone name: cLER-19-B17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183579 is on microarray TOM1: SGN-S1-1-8.1.1.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T194942 EST: SGN-E393616 Direction: 3' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T194942 EST: SGN-E399560 Direction: 3' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T194943 EST: SGN-E393617 Direction: 5' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T195492 EST: SGN-E394166 Direction: 3' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T195959 EST: SGN-E394633 Direction: 5' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T195959 EST: SGN-E399170 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285018Length: 463 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285018 [] (trimmed) CTCCAGGGGAATTACCAAAATGGTATGCAATAGTGGTTGTGATATTCATTTGTGTATATGTTGCTGGATTCGCTTGGTCATGGGGTCCTCTTGGA
TGGCTCGTACCTAGTGAAATTTTCCCACTGGAAATTCGATCAGCTGCACAAAGTATCAATGTCTCAGTGAACATGATCTTCACATTTGCAGTAGC
ACAAGTTTTCTTAACAATGTTGTGTCATTTGAAGTTTGGATTGTTTCTGTTTTTCGCCTTCTTTGTGGTGATTATGACTGTGTTCATATACTTCT
TCTTGCCTGAGACGAAAAATATTCCGATAGAAGAGATGGTGATTGTGTGGAAAGAACATTGGTTCTGGTCTAAGTTCATGACTGAAGTTGATTAT
CCTGGAACTAGGAATGGAACTGCTGTTGAAATGGCTAAAGGGGGTGCTGGTTACATAATTGTATGACTTTAGTTTGGGTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285018] SGN-U584262 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96590 [Download][View] Facility Assigned ID: TPRCW09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5