EST details — SGN-C71867

Search information 
Request: 71867Match: SGN-C71867
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C71867Clone name: cLER-19-G11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184180 is on microarray TOM1: SGN-S1-1-7.2.16.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184180 [TUS-44-B18] Trace: SGN-T198356 EST: SGN-E397030 Direction: 3' Facility: INRA
Clone: SGN-C184180 [TUS-44-B18] Trace: SGN-T198357 EST: SGN-E397031 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284817Length: 517 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E284817 [] (trimmed) CTAATAACACATAGATGGGTTGTGAGGATATTTGCAACACTGGCCTAGTTTTAGGATTAGGCTTTTCTTCAACCGCCGATCACAAATCAAAGAAA
ATAACCACAACACCATTAGTAGGCAAAGGTCCGTGTGTTGGCTTTGAAGAACCTTCACTAACTTTAAGCCTAATTTCCGGTGATCGTACGTACGA
ACAACAGGCGATGAAAATTAGTAAAGATCATCAATCTGCTGATTTGTACAGACAAGATAGTGCTGCCTCTTCCTACTCAAATGCTAGTGTCAAAA
GGGAGAGAGATGTTGGTAGTGAAGAGACAACTACTGAAGTAGAAAGACTTTCCTCCAGAGTTATTAGTGACGAAGATGATGATGGATCTAACGCT
AGAAAGAAACTTAGACTCACTAAACCACAATCTGGACTTTTAGAGGAAAGTTTCAAGATACACAGCACTCTGAATCCTAAACAAAAAACAGGATT
TAACCAAAGAACTCAATTTAAGGCCACGCCAAGTTGAAGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284817] SGN-U568678 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96389 [Download][View] Facility Assigned ID: TPRCU42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5