EST details — SGN-C72124

Search information 
Request: 72124Match: SGN-C72124
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72124Clone name: cLER-1-D3
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178490 is on microarray TOM1: SGN-S1-1-1.1.4.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178490 [TUS-29-E16] Trace: SGN-T183905 EST: SGN-E371576 Direction: 3' Facility: INRA
Clone: SGN-C178490 [TUS-29-E16] Trace: SGN-T183906 EST: SGN-E371577 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280586Length: 380 bp (725 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280586 [] (trimmed) GAAATCTCGTGTTAAGGCTTTCATCAAGCTCGTGAACTACAACCACATCATGCCTACTCGTTACACACTCGATGTGGATCTGAAGGATGTTGTCA
ATGCTGATGTTCTTCAGGCACGTGACAAGAAGGTGACCGCTGCAAAGGAGACCAAGGCTAGGCTTGAGGAGAGGTTCAAGACCGGGAAAAATCGC
TGGTTCTTTACCAAGCTTAGGTTCTGAGCGAAGATTGAATCCGATTTTGATGAAATGGTAATTTTTTTTAGTATTAAAGAGTTTTGAGGAATGTG
TTTGTTATCAAAGATACTATTAGGCTGTTTTTGTGTTTGCACTATTTTATTGATGGATAATTCCTGGCTCTTGTTTCAGTTACCTACAGTTTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280586] SGN-U575052 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92140 [Download][View] Facility Assigned ID: TPRAC14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5