EST details — SGN-C72147

Search information 
Request: 72147Match: SGN-C72147
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72147Clone name: cLER-1-E7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184265 is on microarray TOM1: SGN-S1-1-2.2.16.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184265 [TUS-44-F7] Trace: SGN-T198268 EST: SGN-E396942 Direction: 5' Facility: INRA
Clone: SGN-C184265 [TUS-44-F7] Trace: SGN-T199974 EST: SGN-E398648 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280280Length: 537 bp (814 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280280 [] (trimmed) ATGAACTTTGTTGTGGATTTAACTTGCACAGAGACCAAATATGATTTGATTTGGGTACATAGCTTATTATAGAGACATGCTCACAACTCTTAACA
TCAAGTCCTCCATCAAATTTGATAATACCATCACAAACAGTTGTCAAAGACATGTATACTATGTATCGAGAACAACAAATATGGAACTAGAACGA
GAAGGATTATCAATCTCTTCTTTAATGTTCTCCCTGATAGATTATTCGAACACCACGAAGTAGACAATGGGAAAATGTTACATGGGTCGAGTGTT
CCCAAGAAGCGTCCCCACAAGGTTAGTCACCTGCCAGTACTTTGAAACGCATCGGTCAATACAACTATTTTCACCCATGTTCAACTCCGAGTCCT
TGTACTTGTTCTCGACGCATTTTTTGAAGCATGTATGCGTAAGCTTGTTAAACATCTGCACTCTATACTCCATCTCTTTCTCTGCCATAGAGAAT
ATCTGGTCTCTTTCAAGGTTAGAAGGAACACCAGCCATTATAACCTTTTCAAGAATGGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280280] SGN-U582918 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91834 [Download][View] Facility Assigned ID: TPRAA28TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5